Featured

Powerpoint on the blog

While uploading the ppt file to the blog is great if someone (Tom) wants to borrow some slides for a talk, it makes reading the blog quite cumbersome. In addition to uploading the ppt, you can export each slide as a JPEG in powerpoint. Takes 2 seconds. Then upload them too, embedding them in your post like below. The jpegs can be displayed a slide show, or as a little gallery with thumbnails.

 

 

Or like this:

 

Jared 11/15/19

Surveyed images on Timmy this week, all FFPE, include:
– IJ85 Frontal
– IJ5 Midbrain
– IJ85 Ovary
– IJ85 F. Tube
– IJ85 Liver
– IJ85 Kidney
– IJ85 Ax LN
– IJ85 Esophagus
– IJ85 Spleen
– IJ85 Lung
– IJ85 Ing LN
– IJ85 Mes LN
– IG80 Spleen
– IG80 F. Tube
– IG80 Lung
– IG80 Spinal Cord
– IG80 Liver
– IG80 Ax LN

Tissues observed via Light Sheet this week include:
– IJ85 Endocervix
– HC98 Ing LN
– IG80 F. Tube
– IJ85 F. Tube
– JP10 F. Tube
– HC98 F. Tube

I prepared 40 vials of CFAR rectal buffer for swabs this week.

I continued the process of clearing tissues for Light Sheet.

I sorted mail for Meegan during her absences.

I cut RTL-743 cervix and stored the OCT blocks at -80C.

I sent out the MedSpeed dry ice shipment.

Jared 10/18/19

FFPE tissues surveyed on Timmy this week include:
– IG80 D. Colon
– IJ85 Ileum
– IG80 Ileum
– JP10 Ileum
– HC98 Ileum
– HC98 Duodenum
– JP10 Duodenum
– IG80 Jejunum
– IJ85 Jejunum
– HC98 Ing. LN
– HC98 Heart
– HC98 Spinal Cord
– HC98 Ovary
– HC98 Muscle

Tissues viewed via Light Sheet Microscopy this week include:
– IG80 Frontal
– IJ85 Frontal
– HC98 Frontal
– HC98 Vagina
– HC98 T. Colon
– JP10 T. Colon

Observed one ectocervix cutting (RTL 731) and cut one of my own (RTL 732).

Went over last week’s plasma test and made a plan for a new test.

We will be receiving tissues to be cleared for Light Sheet next week, which will be a major focus.

Sixia-10/18/2019

What I did this week:

Hot iliac lymph nodes

I looked the 100 panels that I took last week but didn’t find any virion… I took another 80 panels for the slides I stained with CD103 this week, will do the analysis next week.

Glans project

Spent two full days on Thing 1 this week. Circled a lot of images this week! I am 2/3 through all the images! Hopefully it will be done soon.

Paraffin sectioning

I sectioned 148 paraffin blocks for Purple (If I counted right)! Some are one slide per block some are two slides per block. Will section more next week!

Rebound

Sectioned two blocks for Yanique, 5 slides per block.

19/10/18 – Meegan

Neonates

Conted PA virions in tissue.  I’m glad we are finding some, both in the original cut sections and the re-sections!  See Roslyn’s blog for the stats!  Next week, I will re-section a bunch of blocks from animal 73 and a couple new ones, and re-section a handful of blocks, but mostly hot blocks I did not section before for 74, to see if we can find some more!

Infectivity Assay

Here are the results of the luciferase assay I ran on two plates of Ed’s viruses:

TZM-bls Plate 1

Viruses tested:

NL43 Delta Env. D64V PAGFP vpr 8/28/19 EJA380 A Harvest

NL43 Delta Env. D64V PAGFP vpr 8/28/19 EJA380 B Harvest

NL43 Delta Env. D64V PAGFP vpr 8/28/19 EJA380 C Harvest

NL43 Delta Env. D64V PAGFP vpr 8/28/19 EJA380 MEDIA CHANGE

CH040 mCherry vpr 8/28/19 EJA381 A Harvest

CH040 mCherry vpr 8/28/19 EJA381 B Harvest

CH040 mCherry vpr 8/28/19 EJA381 C Harvest

CH040 mCherry vpr 8/28/19 EJA381 MEDIA CHANGE

CAP45 MCHERRY-VPR 9/5/19 EJA382 A Harvest

CAP45 MCHERRY-VPR 9/5/19 EJA382 B Harvest

CAP45 MCHERRY-VPR 9/5/19 EJA382 MEDIA CHANGE

190926_TZMbls_Plate1.png

None of the viruses had luminescence values much more than the cells only negative controls. Here is the graph without the positive control:

190926_TZMbls_Plate1_NoPos.png

TZM-bls – Plate 2

Viruses tested:

CH040 mCherry vpr 9/18/19 EJA383 A Harvest

CH040 mCherry vpr 9/18/19 EJA383 B Harvest

CH040 mCherry vpr 9/18/19 EJA383 C Harvest

CH040 mCherry vpr 9/18/19 EJA383 MEDIA CHANGE

CONC. R9BAL CHERRY VPR 12/12/18 EJA343 M HARVEST – 5uL

CONC. R9BAL CHERRY VPR 12/12/18 EJA343 M HARVEST – 1uL

190926_TZMbls_Plate2.png

The CONC. R9 BaL EJA343 with 5uL in the first well had values much higher than the cells only negative control, but most of the other virions did not. Here is the graph without the positive control:

190926_TZMbls_Plate2_NoPos.png

 

BSL2* Training

There is a lab interested in working in our BSL2*, so I have been talking to Mike about planning to train a member of their lab in proper and safe use of the space.

Safe Campus Online Course

Completed the myHR Learn: Safe Campus Online Course.   They released a video about this topic earlier this year, and now they have created a course around the information contained therein.  It was surprisingly informative.

Quartzy/Ordering Update

We have reached a point where we have 20 grants that we can order supplies from, and lab members that are supported by multiple grants.  To streamline the ordering process, I decided to have people begin putting the grant ID numbers onto their orders.  To make this as easy as possible, I went into Quartzy, deleted all of the older grants, and put in all of the new ones with a brief identifier.  I then e-mailed the lab the list of grants, so they can determine which one(s) to use.  It will now be required for every Quartzy order request to contain the Grant ID and price of the item.  General Lab Supplies will be labeled as such, and I will charge them on a rotating list of grants.

Ordering

Placed new and processed incoming orders.

 

Pat-Oct. 18th, 2019

MUC5AC:

I have started to see a consistent neutralization enhancement with our current mucus preps, however, the neutralization has been plateauing at about 80-90% infectivity. To investigate this further I performed a neutralization assay where I included a control where I used a dilution of rituximab with a constant amount of MB03 added to each well. I also had a VRC01 dilution with mucus and a VRC01 dilution by itself. The final control was MB03 alone at the same constant concentration as the antibody dilutions (for this one because there is no antibody the data is plotted using the VRC01 dilution values for convenience). Results are below:

Again we see a clear enhancement of neutralizing activity when MB03 is present, but we also see that the infectivity values plateau around 85%. Interestingly, the MB03 alone and rituximab controls also seem to plateau around this same value. This indicates that the mucus is having some effect on the assay. Koree suggested that in order to see more clearly whether the enhancement of IC50 is due to the plateau or real synergy that I normalize the VRC01-MB03 data. For the above graph the plate viral control is used to calculate % infectivity for both VRC01 and VRC01-MB03, to normalize I changed the viral control value for calculating infecitivty for VRC01-MB03 the average of all 32 well from the MB03 alone and Rit-MB03 controls. The normalized VRC01-MB03 data is plotted below with the original VRC01 data:

By doing this we maintain our 2-fold IC50 enhancement (VRC01: 1.19nM VRC01-MB03: 0.49nM) but now the curve plateaus much closer to 100% (~96%). According to Koree, this would be considered real synergy, which is an exciting result!

I also wanted to test whether the combination of mucus and antibody was having more general effects on viral entry that could explain the plateauing we are seeing. To test this I setup up a neutralization assay using the entry inhibitor maraviroc. I performed a maraviroc titration alone and in the presence of either MB03 alone or Rituximab and MB03 mixed. The idea here was that if the Rit-MB03 enhanced the maraviroc inhibition that we could say there is a more general effect on infectivity. The results are below:

Unfortunately, I started my maraviroc titration too high and thus did not capture the top end of the graph, which in this experiment is the most important part. There is a hint of something happening with the MB03-Rit wells but i don’t feel comfortable interpreting this too much without getting the tops of these curves. I plan to redo this next week and get the plateaus for these curves to see of there is any difference between them.

Next week will be a bit odd as I will be attending the CFAR meeting on Monday and Tuesday and then Thursday afternoon and Friday morning I will be at a retreat for my training grant in the suburbs. I still hope to get some stuff done in the lab but it will not be the most productive week. I will redo the maraviroc experiment and test a few new mucus preps in the neut assay as well as continue to take care of mucus cells and continue the pH5 experiment. I also hope to do some pilot assays to get some competition like ELISAs up and running for MUC16.

Divya 10/18/19

P24 – Ran samples for Tahmina. Few needs to be re-run due to higher concentration.

KSHV – I plated and collected SLK.219 cells induced with Doxycycline for next set of biopsy. Split SLK.219, and TZM b cells for next week. Sixia sectioned one set of biopsy tissues and I stained them for LANA. Today, I did imaging for 3 slides and took couple of panel on each section for those slide. I have notice that we need to section more deep in the blocks as there is lot of connective tissues to get better images for staining. I will analyse the images soon for it.

FRT image – I finished analysis of JP85 R.Endo2 images.

 

 

Roslyn 10.18.19

This week I stained and fixed the ten slides from A19X074 that Meegan cut deeper into. These blocks were all very hot by PET scan. I imaged these slides and started to analyze them. I am really happy that we went back to cut deeper into blocks because in both A19X073 and A19X074 we found more virions in the hot blocks that we previously checked. They still do not have as many virions as the first set of animals (A19X042 and A19X038), but it’s more than what we first found. We will do a second round of cutting next week. With the CFAR Symposium, I do not expect to finish this next set next week, but will finish them the following week. Both weeks are short weeks for me lab wise between the symposium and leaving for my sister’s wedding. Slide1Slide2

With one week to go, I also worked a lot of the CFAR Symposium.

Sixia-10/14/2019

Last week I did:

Hot iliac lymph nodes

Finished analyzing half of the images that I took the week before, find 2 virions, will keep looking. And I tool another 80 panels for the L_EXT iliac lymph node and 20 panels for the L_INT iliac lymph nodes, will finish analysis this week.

First cell infected

I finished analysis for the rest of the images that Shoaib marked as ready.

Rebound

On Wednesday, I sectioned 4 blocks for Shoaib, 30 slides per block;

Then on Friday I sectioned 5 blocks for him again, 20 slides per block;

I also sectioned 4 blocks for Yanique, 5 slides per blcok.

Glans project

I circled more images this week, but not a lot, will focus on this this week and will have everything done before mid November so G can write his report.

KSHV

On Monday I harvested the 48 hour infected colon tissue, and sectioned some slides, Divya stained them.

Divya and I picked up the colon tissue from the pathology lab on Tuesday, then I cut the colon tissue and infected these tissues with the KSHV virus we made last week. Tissues are harvested on Friday.

Paraffin sectioning

I sectioned all the blocks from animal HC98 for Purple, didn’t count how many block were there. Will continue sectioning the rest of the paraffin block this week.

Joe Oct 11, 2019

This past week I helped Joao fix two different cell plates and added antibodies. He imaged these two plates. Later in the week, I took a new plate prepared by Joao and added a new nuclear stain called NucSpot Live 650 Nuclear Stain (https://biotium.com/wp-content/uploads/2017/03/PI-40082-1.pdf). I added stain to live cells and imaged immediately after. The cells didn’t look very healthy under the scope; I don’t know if this was due to the stain or simply from the virus. Meegan helped with the Luciferase assay after imaging. Results are below (Gain 3000)

I also tried another Gibson transformation this past week pmcsg53 and Tet and Tom in STBL4s and then in TOP10s. Didn’t work unfortunately. We think the vector we got was bad; I spoke with Monica Rosas Lemus and she said she can provide a new pmcsg53 vector next week.

Also, since coming back from vacation, I noticed the dishwasher is acting funny. If anyone knows anything, let me know please.

Isa Oct 11th 2019

P01

I received 44 heart samples last week the day before leaving for Palm Springs. I also received 20 A0N005 monkey samples 2 days ago:

TulaneA0N005

I weighted and started the homogeneization of these guys. Next week I ll extract nucleic acids and qPCR and RTqPCR for Gag (fingers crossed the qPCR machine will be fixed).

Before leaving I processed and qPCRed heart samples from 05D369 and 02C060 monkeys, plus samples from Tulane (GJ04Nxsf). Only tulane heart samples has Gag DNA, not other heart samples. I find Gag in kidney and jejeunum too in 02C060 rebound monkey (the cursed one):

05D369 and 02C060 hearts qPCR

In parallel I m cloning CD11b and do in vitro transcription. It will allow me to quantify CD11b RNAs in heart samples to have an idea of macrophage content, and if it s content is higher in non treated animals (Tulane) versus ART animals (Rebound) after RT.

In parallel I m trying to amplify and sequence Nef and see if luciferase is still present in rebound monkey viruses after ART. For this I used two different samples to set up. One is BB, a positive sample from leather punch monkey infected with a “classic” SIVmac239; the other is #20, a positive sample from rebound monkey infected with K5314-pSIVmac239-LucFF.

I won t write here all the different attempts with 5 different couples of primers, 8 different hybridization temperature, but at the end I managed to amplify Nef from the SIVmac239 infected monkeys, and the sequence confirm Nef  (BB sample is a 4 days infection and necropsy). The best results were obtained with these 2 primers and applied gradiant  matrices below

Env SIVmac239F Ramon F cagtcaccattatgtctggattg
Nef SIVmac239 R (LTR3) CATCAAGAAAGTGGGCGTTC

matrix gradiantnefluc gradiant nested after first pcr 09262019

Among all the conditions that worked for Nef on SIVmac239, I sent this guy to sequence (BB sample, 1st PCR Tm 60C; nested 70C; green color) with the primers I used for nested PCR:

Nef SIVmac239 nested F (Env) TCAGCAACTGCAGAACCTTG
Nef SIVmac239 nested R (LTR3 CATCAAGAAAGTGGGCGTTC

nested BBBH

Sequence came back OK, I observed a G in position 277 of Nef instead of the supposed T in SIVmac239, but some sequences of mac239 shows a T instead of the G so I think it s not a real mutation.

So I found the conditions for amplification of Nef on SIVmac239, but this does not work on Rebound monkeys samples who has a luciferase in plus (see map below) that makes 2kb supplemental. Ramon is helping me now to design another assay that would work better with a shorter 1st PCR fragment. Also, since these monkeys are on ART, there is very few genome copies in the sample and that make it extremely complicated even more than the amplicon is big size. I tried on 3 other samples, diluted or now, with different conditions again, it never worked. I found the original plasmid and I will try monday to see if these conditions that work on SIVmac wo luciferase work on the one with Luciferase (it should since I designed the primers in thsi way). The try on the plasmid  will at least validate the primers and conditions  for luciferase-nef detection

K5314-pSIVmac239-LucFF.6ATRi

I went to the FLOW multiple time to try to characterize infected cells from heart digestion. I digested at least 15 hearts these 2 last months. As I was afraid off, fresh live tissue don t like to be carried over the country for 24h, the majority of cells are dead. I will go again next week go and test one tube of every digestion just with a live dead exclusion dye and CD45, to see if any of these tube as exploitable cells. The “good” thing is that, not like Tulane hearts, the rebound monkey heart digestions are done on site, then I have more hope that these guys can be alive. That would be great if I had enough for sorting and qPCR (and in my dream, enough for qVOA).